La molécula del mes

October 10, 2011 frontPage, work

“La Molécula Del Mes” es un ejercicio práctico de electrónica y programación. Es un artefacto que aparece como resultado de la informática aplicada a dispositivos electrónicos programables, en este caso un Arduino con un arreglo de 16 leds conectado a uno de sus puertos. el resultado es un sistema pdv (persistencia de visión) por el cual se representa de manera arbitraria una secuencia molecular en este caso la “leptina”, molecula humana informativa responsable de desatar el apetito.

Homo sapiens lipin 3 (LPIN3), mRNA

NCBI Reference Sequence: NM_022896.1 GenBank Graphics
gi|74271887|ref|NM_022896.1| Homo sapiens lipin 3 (LPIN3), mRNA
CGAAGACACTCACCTGTGGAGCCTGTGCACGTAGGTAGAGGCGGCGGCTCTGAGTCCAGGAGCTCCAGTG GGCAGCTCCCCAGCACCAGCCATGAACTACGTGGGGCAGCTGGCGGAGACGGTGTTTGGGACGGTGAAGG AGCTGTACCGGGGCCTGAACCCAGCCACACTGAGCGGCGGCATTGACGTGCTGGTGGTGAAGCAGGTGGA CGGCTCGTTCCGGTGCTCACCCTTCCACGTGCGTTTTGGCAAGCTGGGCGTCCTGCGGTCGCGGGAGAAG GTGGTAGACATTGAGCTCAATGGGGAGCCTGTGGACTTGCACATGAAGCTTGGGGACAGCGGGGAGGCCT
  • 2011 – 2012
  • Ceropunto. MAMM. Museo de Arte Moderno de Mendoza. Argentina.
  • Ceropunto. En Museo de Arte J. Castagnino. Rosario. Argentina.